null
Cusabio

TYR Clone BC027179 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL025394HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TYR
Gene ID:
7299
Accession #:
BC027179
Vector:
pUC
€214.00

Description

TYR Clone BC027179 pUC | Cusabio

Gene Name: TYR

Gene ID: 7299

Accession Number: BC027179

Plasmid: pUC

Sequence: ATGCTCCTGGCTGTTTTGTACTGCCTGCTGTGGAGTTTCCAGACCTCCGCTGGCCATTTCCCTAGAGCCTGTGTCTCCTCTAAGAACCTGATGGAGAAGGAATGCTGTCCACCGTGGAGCGGGGACAGGAGTCCCTGTGGCCAGCTTTCAGGCAGAGGTTCCTGTCAGAATATCCTTCTGTCCAATGCACCACTTGGGCCTCAATTTCCCTTCACAGGGGTGGATGACCGGGAGTCGTGGCCTTCCGTCTTTTATAATAGGACCTGCCAGTGCTCTGGCAACTTCATGGGATTCAACTGTGGAAACTGCAAGTTTGGCTTTTGGGGACCAAACTGCACAGAGAGACGACTCTTGGTGAGAAGAAACATCTTCGATTTGAGTGCCCCAGAGAAGGACAAATTTTTTGCCTACCTCACTTTAGCAAAGCATACCATCAGCTCAGACTATGTCATCCCCATAGGGACCTATGGCCAAATGAAAAATGGATCAACACCCATGTTTAACGACATCAATATTTATGACCTCTTTGTCTGGATGCATTATTATGTGTCAATGGATGCACTGCTTGGGGGATCTGAAATCTGGAGAGACATTGATTTTGCCCATGAAGCACCAGCTTTTCTGCCTTGGCATAGACTCTTCTTGTTGCGGTGGGAACAAGAAATCCAGAAGCTGACAGGAGATGAAAACTTCACTATTCCATATTGGGACTGGCGGGATGCAGAAAAGTGTGACATTTGCACAGATGAGTACATGGGAGGTCAGCACCCCACAAATCCTAACTTACTCAGCCCAGCATCATTCTTCTCCTCTTGGCAGATTGTCTGTAGCCGATTGGAGGAGTACAACAGCCATCAGTCTTTATGCAATGGAACGCCCGAGGGACCTTTACGGCGTAATCCTGGAAACCATGACAAATCCAGAACCCCAAGGCTCCCCTCTTCAGCTGATGTAGAATTTTGCCTGAGTTTGACCCAATATGAATCTGGTTCCATGGATAAAGCTGCCAATTTCAGCTTTAGAAATACACTGGAAGAGATGGGATTTCTCCATGTTGGCTGGGCTGGTCTCAAACTCCTGACCTCAAGAGATCCACCACCTTGGCCTCCCAAAATGCTGGGATTACAGGCTTGA

Length: 1134

View AllClose