null
Cusabio

TYROBP Clone BC011175

(No reviews yet) Write a Review
SKU:
CSB-CL025398HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TYROBP
Gene ID:
7305
Accession #:
BC011175
Vector:
pENTR223.1 or pUC
€214.00

Description

TYROBP Clone BC011175 | Cusabio

Gene Name: TYROBP

Gene ID: 7305

Accession Number: BC011175

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGGGGACTTGAACCCTGCAGCAGGCTCCTGCTCCTGCCTCTCCTGCTGGCTGTAAGTGGTCTCCGTCCTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTGGCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCAGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGA

Length: 342

View AllClose