null
Cusabio

VARS2 Clone BC009355 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL735951HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VARS2
Gene ID:
57176
Accession #:
BC009355
Vector:
pUC
€601.00

Description

VARS2 Clone BC009355 pUC | Cusabio

Gene Name: VARS2

Gene ID: 57176

Accession Number: BC009355

Plasmid: pUC

Sequence: ATGACCTCCCTCTGCGGGGACTGGTTGCAGGGTCTTCACCGGTTTGTGGCCCGGGAAAAGATAATGTCTGTGCTGAGTGAACGGGGCCTATTCCGGGGCCTCCAGAACCACCCCATGGTACTGCCCATCTGCAGCCGTTCTGGGGATGTGATAGAATACCTGCTGAAGAACCAGTGGTTTGTCCGCTGCCAGGAAATGGGGGCCCGAGCTGCCAAGGCTGTGGAGTCGGGGGCCCTGGAGCTCAGTCCCTCCTTCCACCAGAAGAACTGGCAGCACTGGTTTTCCCATATTGGGGACTGGTGTGTCTCCCGGCAGCTGTGGTGGGGCCATCAGATTCCAGCCTACCTGGTTGTAGAGGACCATGCGCAGGGAGAAGAGGACTGTTGGGTGGTTGGGCGGTCAGAGGCTGAGGCCAGAGAGGTAGCAGCGGAACTGACAGGGAGGCCAGGGGCAGAGCTGACCCTGGAGAGGGATCCTGATGTCCTAGACACATGGTTTTCTTCTGCCCTGTTCCCCTTTTCTGCCCTGGGCTGGCCCCAAGAGACCCCAGACCTTGCTCGTTTCTACCCCCTGTCACTTTTGGAAACGGGCAGCGACCTTCTGCTGTTCTGGGTGGGCCGCATGGTCATGTTGGGGACCCAGCTCACAGGGCAGCTGCCCTTCAGCAAGGTGCTTCTTCATCCCATGGTTCGGGACAGGCAGGGCCGGAAGATGAGCAAGTCCCTGGGGAATGTGCTGGACCCAAGAGACATCATCAGTGGGGTGGAGATGCAGTTGCTGCAGGAAAAGCTGAGAAGCGGAAATTTGGACCCTGCAGAGCTGGCCATTGTGGCTGCAGCACAGAAAAAGGACTTTCCTCACGGGATCCCTGAGTGTGGGACAGATGCCCTGAGATTCACACTCTGCTCCCATGGAGTTCAGGCGGGCGACTTGCACCTGTCAGTCTCTGAGGTCCAGAGCTGCCGACATTTCTGCAACAAGATCTGGAATGCTCTTCGCTTTATCCTCAATGCTTTAGGGGAGAAATTTGTGCCACAGCCTGCTGAGGAGCTGTCTCCCTCCTCCCCGATGGATGCCTGGATCCTGAGCCGCCTTGCCCTGGCTGCCCAGGAGTGTGAGCGGGGCTTCCTCACCCGAGAGCTCTCGCTCGTCACTCATGCCCTGCACCACTTCTGGCTTCACAACCTCTGTGACGTCTACCTGGAGGCTGTGAAGCCCGTGCTGTGGCACTCGCCCCGCCCCCTGGGGCCCCCTCAGGTCCTGTTCTCCTGCGCTGACCTCGGCCTCCGCCTCCTGGCCCCACTGATGCCCTTCCTGGCTGAAGAGCTCTGGCAGAGGCTGCCCCCCAGGCCTGGTTGCCCCCCTGCCCCCAGCATCTCGGTTGCCCCCTACCCTAGCGCCTGCAGCTTGGAGCACTGGCGCCAGCCAGAGCTGGAGCGGCGCTTCTCCCGGGTCCAAGAGGTCGTGCAGGTGCTAAGGGCTCTCCGAGCCACGTACCAGCTCACCAAAGCCCGGCCCCGAGTGCTGCTGCAGAGCTCAGAGCCTGGGGACCAGGGCCTCTTCGAGGCCTTCTTGGAGCCCCTGGGCACCCTGGGCTACTGTGGGGCTGTGGGCCTGTTACCCCCAGGCACAGCAGCTCCCTCCGGCTGGGCCCAGGCTCCACTCAGTGACACGGCTCAAGTCTACATGGAGCTGCAGGGCCTGGTGGACCCGCAGATCCAGCTACCTCTGTTAGCCGCCCGAAGGTACAAGTTGCAGAAGCAGCTTGATAGCCTCACAGCCAGGACCCCATCAGAAGGGGAGGCAGGGACTCAGAGGCAACAAAAGCTTTCTTCCCTCCAGCTGGAATTGTCAAAACTGGACAAGGCAGCCTCTCACCTCCGGCAGCTGATGGATGAGCCTCCAGCCCCAGGGAGCCCGGAGCTCTAA

Length: 1929

View AllClose