null

ZYX Clone BC008743

(No reviews yet) Write a Review
SKU:
CSB-CL027165HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZYX
Gene ID:
7791
Accession #:
BC008743
Vector:
pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

ZYX Clone BC008743 | Cusabio

Gene Name: ZYX

Gene ID: 7791

Accession Number: BC008743

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCCCCCCGCCCGTCTCCCGCGATCTCCGTTTCGGTCTCGGCTCCGGCTTTTTACGCCCCGCAGAAGAAGTTCGGCCCTGTGGTGGCCCCAAAGCCCAAAGTGAATCCCTTCCGGCCCGGGGACAGCGAGCCTCCCCCGGCACCCGGGGCCCAGCGCGCACAGATGGGCCGGGTGGGCGAGATTCCCCCGCCGCCCCCGGAAGACTTTCCCCTGCCTCCACCTCCCCTTGCTGGGGATGGCGACGATGCAGAGGGTGCTCTGGGAGGTGCCTTCCCGCCGCCCCCTCCCCCGATCGAGGAATCATTTCCCCCTGCGCCTCTGGAGGAGGAGATCTTCCCTTCCCCGCCGCCTCCTCCGGAGGAGGAGGGAGGGCCTGAGGCCCCCATACCGCCCCCACCACAGCCCAGGGAGAAGGTGAGCAGTATTGATTTGGAGATCGACTCTCTGTCCTCACTGCTGGATGACATGACCAAGAATGATCCTTTCAAAGCCCGGGTGTCATCTGGATATGTGCCCCCACCAGTGGCCACTCCATTCAGTTCCAAGTCCAGTACCAAGCCTGCAGCCGGGGGCACAGCACCCCTGCCTCCTTGGAAGTCCCCTTCCAGCTCCCAGCCTCTGCCCCAGGTTCCGGCTCCGGCTCAGAGCCAGACACAGTTCCATGTTCAGCCCCAGCCCCAGCCCAAGCCTCAGGTCCAACTCCATGTCCAGTCCCAGACCCAGCCTGTGTCTTTGGCTAACACCCAGCCCCGAGGGCCCCCAGCCTCATCTCCGGCTCCAGCCCCTAAGTTTTCTCCAGTGACTCCTAAGTTTACTCCTGTGGCTTCCAAGTTCAGTCCTGGAGCCCCAGGTGGATCTGGGTCACAACCAAATCAAAAATTGGGGCACCCCGAAGCTCTTTCTGCTGGCACAGGCTCCCCTCAACCTCCCAGCTTCACCTATGCCCAGCAGAGGGAGAAGCCCCGAGTGCAGGAGAAGCAGCACCCCGTGCCCCCACCGGCTCAGAACCAAAACCAGGTGCGCTCCCCTGGGGCCCCAGGGCCCCTGACTCTGAAGGAGGTGGAGGAGCTGGAGCAGCTGACCCAGCAGCTAATGCAGGACATGGAGCATCCTCAGAGGCAGAATGTGGCTGTCAACGAACTCTGCGGCCGATGCCATCAACCCCTGGCCCGGGCGCAGCCAGCCGTCCGCGCTCTAGGGCAGCTGTTCCACATCGCCTGCTTCACCTGCCACCAGTGTGCGCAGCAGCTCCAGGGCCAGCAGTTCTACAGTCTGGAGGGGGCGCCGTACTGCGAGGGCTGTTACACTGACACCCTGGAGAAGTGTAACACCTGCGGGGAGCCCATCACTGACCGCATGCTGAGGGCCACGGGCAAGGCCTATCACCCGCACTGCTTCACCTGTGTGGTCTGCGCCCGCCCCCTGGAGGGCACCTCCTTCATCGTGGACCAGGCCAACCGGCCCCACTGTGTCCCCGACTACCACAAGCAGTACGCCCCGAGGTGCTCCGTCTGCTCTGAGCCCATCATGCCTGAGCCTGGCCGAGATGAGACTGTGCGAGTGGTCGCCCTGGACAAGAACTTCCACATGAAGTGTTACAAGTGTGAGGACTGCGGGAAGCCCCTGTCGATTGAGGCAGATGACAATGGCTGCTTCCCCCTGGACGGTCACGTGCTCTGTCGGAAGTGCCACACTGCTAGAGCCCAGACCTGA

Length: 1719

View AllClose