ZZZ3 Clone BC035079

(No reviews yet) Write a Review
SKU:
CSB-CL810302HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZZZ3
Gene ID:
26009
Accession #:
BC035079
Vector:
pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

ZZZ3 Clone BC035079 | Cusabio

Gene Name: ZZZ3

Gene ID: 26009

Accession Number: BC035079

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGATAGATCTTTGGTTGTACAGTTATCAGAGACTATTACAGACGATTGCTGTACTCGAGGCTCAGCGTTCTCAAGCAGTCCAAGACCTTGAAAGTTTAGGCAGGCACCAGAGAGAAGCACTGAAAAATCCCATTGGATTTGTGGAAAAACTCCAGAAGAAGGCTGATATTGGGCTTCCATATCCACAGAGAGTTGTTCAATTGCCTGAGATCGTATGGGACCAATATACCCATAGCCTTGGGAATTTTGAAAGAGAATTTAAAAATCGTAAAAGACATACTAGAAGAGTTAAGCTAGTTTTTGGTAAAGTAGGTTTACCTGCTAGACCAAAAAGTCCTTTAGATCCTAAGAAGGATGGAGAGTCCCTTTCATATTCTATGTTGCCTTTGAGTGATGGTCCAGAAGGCTCAAGCAGTCGTCCTCAGATGATAAGAGGACGCTTGTGTGATGATACCAAACCTGAAACATTTAACCAGTTGTGGACTGTTGAAGAACAGAAAAAGCTGGAACAGCTACTCATCAAATACCCTCCTGAAGAAGTAGAATCTCGACGCTGGCAGAAGATAGCAGATGAATTGGGCAACAGGACAGCAAAACAGGTTGCCAGCCAAGTACAGAAGTATTTCATAAAGCTAACTAAAGCTGGCATTCCAGTACCAGGCAGAACACCAAACTTATGTATATACTCCAAAAAGTCTTCAACAAGCAGACGACAGCACCCTCTTAATAAGCATCTCTTTAAGCCTTCCACTTTCATGACTTCACATGAACCGCCAGTGTATATGGATGAAGATGATGACCGATCTTGTTTTCATAGCCACATGAACACTGCTGTTGAAGATGCATCAGATGACGAAAGTATTCCTATCATGTATAGGAATTTACCTGAATATAAAGAACTATTACAGTTTAAAAAGTTAAAGAAGCAGAAACTTCAGCAAATGCAAGCTGAAAGTGGATTTGTGCAACATGTGGGCTTTAAGTGTGATAACTGTGGCATAGAACCCATCCAGGGTGTTCGGTGGCATTGCCAGGATTGTCCTCCAGAAATGTCTTTGGATTTCTGTGATTCTTGTTCAGACTGTCTACATGAAACAGATATTCACAAGGAAGATCACCAATTAGAACCTATTTATAGGTCAGAGACATTCTTAGACAGAGACTACTGTGTGTCTCAGGGCACCAGTTACAATTACCTTGACCCAAACTACTTTCCAGCAAACAGATGA

Length: 1230

View AllClose