Cusabio

ZZZ3 Clone BC035818

(No reviews yet) Write a Review

SKU:: CSB-CL810302HU1
UPC:
MPN:
Availability:: Inquiry
Size:: 10 μg plasmid + 200μl Glycerol
Gene:: ZZZ3
Gene ID:: 26009
Accession #:: BC035818
Vector:: pENTR223.1 or pUC

€516.00

Current Stock:

Quantity:

Frequently bought together:

Description

Description

ZZZ3 Clone BC035818 | Cusabio

Gene Name: ZZZ3

Gene ID: 26009

Accession Number: BC035818

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTGCTTCCCGATCTACTCGTGTTACAAGATCAACAGTGGGGTTAAACGGCTTGGATGAATCTTTTTGTGGTAGAACTTTAAGGAATCGTAGCATTGCGCATCCTGAAGAAATCTCTTCTAATTCTCAAGTACGATCAAGATCACCAAAGAAGAGACCAGAGCCTGTGCCAATTCAGAAAGGAAATAATAATGGGAGAACCACTGATTTAAAACAGCAGAGTACCCGAGAATCATGGGTAAGCCCTAGGAAAAGAGGACTTTCTTCTTCAGAAAAGGATAACATAGAAAGGCAGGCTATAGAAAATTGTGAGAGAAGGCAAACAGAACCTGTTTCACCAGTTTTAAAAAGAATTAAGCGTTGTCTTAGATCTGAAGCACCAAACAGTTCAGAAGAAGATTCTCCTATAAAATCAGACAAGGAGTCAGTAGAACAGAGGAGTACAGTAGTGGACAATGATGCAGATTTTCAAGGGACTAAACGAGCTTGTCGATGTCTTATACTGGATGATTGTGAGAAAAGGGAAATTAAAAAGGTGAATGTCAGTGAGGAAGGGCCACTTAATTCTGCAGTAGTTGAAGAAATCACAGGCTATTTGGCTGTCAATGGTGTTGATGACAGTGATTCAGCTGTTATAAACTGTGATGACTGTCAGCCTGATGGGAACACTAAACAAAATAGCATTGGTTCCTATGTGTTACAGGAAAAATCAGTAGCTGAAAATGGGGATACGGATACCCAAACTTCAATGTTCCTTGATAGTAGGAAGGAGGACAGTTATATAGACCATAAGGTGCCTTGCACAGATTCACAAGTGCAGGTCAAGTTGGAGGACCACAAAATAGTAACTGCCTGCTTGCCTGTGGAACATGTTAATCAGCTGACTACTGAGCCAGCTACAGGGCCCTTTTCTGAAACTCAGTCATCTTTAAGGGATTCTGAGGAGGAAGTAGATGTGGTGGGAGATAGCAGTGCCTCAAAAGAGCAGTGTAAAGAAAACACCAATAACGAACTGGACACAAGTCTTGAGAGTATGCCAGCCTCCGGAGAACCTGAACCATCTCCTGTTCTAGACTGTGTTTCAGCTCAAATGATGTCTTTATCAGAACCTCAAGAACATCGTTATACTCTGAGAACCTCACCACGAAGGGCAGCCCCTACCAGAGGTAGTCCCACTAAAAACAGTTCTCCTTACAGAGAAAATGGACAATTTGAGGAGAATAATCTTAGTCCTAATGAAACAAATGCAACTGTTAGTGATAATGTAAGTCAATCTCCTACAAATCCTGGTGAAATTTCTCAAAATGAAAAAGGGATATGTTGTGACTCTCAAAATAATGGAAGTGAAGGAGTAAGTAAACCACCCTCAGAGGCAAGACTCAATATTGGACATTTGCCATCTGCCAAAGAGAGTGCCAGTCAGCACATTACAGAAGAGGAAGATGATGATCCTGATGTTTATTACTTTGAATCAGATCATGTGGCACTGAAACACAACAAAGATTATCAGAGACTATTACAGACGATTGCTGTACTCGAGGCTCAGCGTTCTCAAGCAGTCCAAGACCTTGAAAGTTTAGGCAGGCACCAGAGAGAAGCACTGAAAAATCCCATTGGATTTGTGGAAAAACTCCAGAAGAAGGCTGATATTGGGCTTCCATATCCACAGAGAGTTGTTCAATTGCCTGAGATCGTATGGGACCAATATACCCATAGCCTTGGGAATTTTGAAAGAGAATTTAAAAATCGTAAAAGACATACTAGAAGAGTTAAGCTAGTTTTTGATAAAGTAGGTTTACCTGCTAGACCAAAAAGTCCTTTAGATCCTAAGAAGGATGGAGAGTCCCTTTCATATTCTATGTTGCCTTTGAGTGATGGTCCAGAAGGCTCAAGCAGTCGTCCTCAGATGATAAGAGGACGCTTGTGTGATGATACCAAACCTGAAACATTTAACCAGTTGTGGACTGTTGAAGAACAGAAAAAGCTGGAACAGCTACTCATCAAATACCCTCCTGAAGAAGTAGAATCTCGACGCTGGCAGAAGATAGCAGATGAATTGGGCAACAGGACAGCAAAACAGGTTGCCAGCCGAGTACAGAAGTATTTCATAAAGCTAACTAAAGCTGGCATTCCAGTACCAGGCAGAACACCAAACTTATATATATACTCCAAAAAGTCTTCAACAAGCAGACGACAGCACCCTCTTAATAAGCATCTCTTTAAGCCTTCCACTTTCATGACTTCACATGAACCGCCAGTGTATATGGATGAAGATGATGACCGATCTTGTTTTCATAGCCACATGAACACTGCTGTTGAAGATGCATCAGATGACGAAAGTATTCCTATCATGTATAGGAATTTACCTGAATATAAAGAACTATTACAGTTTAAAAAGTTAAAGAAGCAGAAACTTCAGCAAATGCAAGCTGAAAGTGGATTTGTGCAACATGTGGGCTTTAAGTGTGATAACTGTGGCATAGAACCCATCCAGGGTGTTCGGTGGCATTGCCAGGATTGTCCTCCAGAAATGTCTTTGGATTTCTGTGATTCTTGTTCAGACTGTCTACATGAAACAGATATTCACAAGGAAGATCACCAATTAGAACCTATTTATAGGTCAGAGACATTCTTAGACAGAGACTACTGTGTGTCTCAGGGCACCAGTTACAATTACCTTGACCCAAACTACTTTCCAGCAAACAGATGA

Length: 2712

View AllClose

Related Products
Customers Also Viewed

Customers Also Viewed

EGR1-GFP (Bsd) Lentivirus | LVP1119-B

GenTarget

€552.00 - €709.00

EGR1-GFP (Bsd) Lentivirus | LVP1119-B | GenTargetDescription:Pre-made lentivirus express GFP reporter under the promoter of human early growth response gene-1 (EGR1) . This lentivirus contains the...

pAAVK-EF1α-MCS1-CMV-mRFP AAVancedTM Cloning and Expression Vecto — Add to Cart

Quick view

pAAVK-EF1α-MCS1-CMV-mRFP AAVanced™ Cloning and Expression Vector

System Biosciences

€723.00

pAAVK-EF1α-MCS1-CMV-mRFP AAVancedTM Cloning and Expression Vector. Cat# AAV538A. Supplier: SBI System Biosciences Take advantage of AAV-based gene delivery for gene therapy development and...

ZZZ3 Clone BC035079

Cusabio

€214.00

ZZZ3 Clone BC035079 | CusabioGene Name: ZZZ3Gene ID: 26009Accession Number: BC035079Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

ZXDC Clone BC002940

Cusabio

€214.00

ZXDC Clone BC002940 | CusabioGene Name: ZXDCGene ID: 79364Accession Number: BC002940Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

ZSWIM2 Clone BC031094

Cusabio

€347.00

ZSWIM2 Clone BC031094 | CusabioGene Name: ZSWIM2Gene ID: 151112Accession Number: BC031094Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

System Biosciences

€2,402.00

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR...

AAV Packaging Mix (Serotype 6) & DNAfectin Combo Pack | AAV1006-G2100

ABMGood

€776.00

abm | AAV Packaging Mix (Serotype 6) & DNAfectin Combo Pack | AAV1006-G2100Quantity:1 KitTiter:N/AShipping Condition:Refer to Manual/DatasheetStorage Condition:Refer to Manual/Datasheet

pAAVK-EF1α-MCS1-CMV-Puro AAVancedTM Cloning and Expression Vecto — Add to Cart

Quick view

pAAVK-EF1α-MCS-CMV-Puro AAVanced™ Cloning and Expression Vector — Add to Cart

Quick view

pAAVK-EF1α-MCS1-CMV-Puro AAVanced™ Cloning and Expression Vector

System Biosciences

€723.00

pAAVK-EF1α-MCS1-CMV-Puro AAVancedTM Cloning and Expression Vector. Cat# AAV537A. Supplier: SBI System Biosciences Take advantage of AAV-based gene delivery for gene therapy development and...

pAAVK-EF1α-MCS1-CMV-MCS2 AAVancedTM Cloning and Expression Vecto — Add to Cart

Quick view

pAAVK-EF1α-MCS1-CMV-MCS2 AAVanced™ Cloning and Expression Vector

System Biosciences

€723.00

pAAVK-EF1α-MCS1-CMV-MCS2 AAVancedTM Cloning and Expression Vector. Cat# AAV503A. Supplier: SBI System Biosciences Take advantage of AAV-based gene delivery for gene therapy development and...

ZYX Clone BC008743

Cusabio

€347.00

ZYX Clone BC008743 | CusabioGene Name: ZYXGene ID: 7791Accession Number: BC008743Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

ZYG11B Clone BC029832

Cusabio

€214.00

ZYG11B Clone BC029832 | CusabioGene Name: ZYG11BGene ID: 79699Accession Number: BC029832Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

ZWINT Clone BC020979

Cusabio

€214.00

ZWINT Clone BC020979 | CusabioGene Name: ZWINTGene ID: 11130Accession Number: BC020979Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

Plasma Membrane Labeling Lentivirus (LCK)(GFP) | LVP712

ABMGood

€784.00

abm | Plasma Membrane Labeling Lentivirus (LCK)(GFP) | LVP712Quantity:10 x 100 µlTiter:10^7 IU/mlShipping Condition:Dry IceStorage Condition:-80°C

AAV Serotype Blast™ Kit | AAV099

ABMGood

€1,001.00

abm | AAV Serotype Blast™ Kit | AAV099Quantity:9 x 100 μlTiter:1x10^9 GC/mlShipping Condition:Dry IceStorage Condition:-80°C

AAV Packaging Mix (Serotype 5) | AAV1005

ABMGood

€626.00

abm | AAV Packaging Mix (Serotype 5) | AAV1005Quantity:100 µgTiter:N/AShipping Condition:Ambient TemperatureStorage Condition:-20°C

Anti-Mesothelin (SS1) TCAR Lentivirus | LVP750

ABMGood

€1,496.00

abm | Anti-Mesothelin (SS1) TCAR Lentivirus | LVP750Quantity:10^8 IU/ml; 550 µlTiter:N/AShipping Condition:Dry IceStorage Condition:-80°C

Adeno-1™ Complete Cloning Kit | A100

ABMGood

€1,196.00

abm | Adeno-1™ Complete Cloning Kit | A100Quantity:1 KitTiter:N/AShipping Condition:Refer to Manual/DatasheetStorage Condition:Refer to Manual/Datasheet

pAAVK-EF1α-MCS1-CMV-EGFP AAVancedTM Cloning and Expression Vecto — Add to Cart

Quick view

pAAVK-EF1α-MCS1-CMV-EGFP AAVanced™ Cloning and Expression Vector

System Biosciences

€723.00

pAAVK-EF1α-MCS1-CMV-EGFP AAVancedTM Cloning and Expression Vector. Cat# AAV536A. Supplier: SBI System Biosciences Take advantage of AAV-based gene delivery for gene therapy development and...

miRZip-1248 anti-miR-1248 microRNA construct bacterial streak

System Biosciences

€912.00

miRZip-1248 anti-miR-1248 microRNA construct bacterial streak. Cat# MZIP1248-PA. Supplier: SBI System Biosciences

Exosome-Depleted FBS Media Supplement Heat Inactivated

System Biosciences

€243.00 - €1,002.00

Bovine exosome-free FBS that has been heat inactivated, for labs that would like to use Exo-FBS but require heat inactivation. Heat inactivated using a highly quality-controlled...

Exosome-Depleted FBS Media Supplement

System Biosciences

€227.00 - €988.00

Bovine exosome-depleted FBS, for isolating exosomes from cultured cells without the complication of bovine exosomes that are present in conventional FBS. Exosome-sized vesicles removed Very low...

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP)

System Biosciences

€1,330.00

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP). Cat# GE624A. Supplier: SBI System Biosciences Easily create reporter cell lines that express GFP from your...

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

System Biosciences

€2,402.00

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer...

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS)

System Biosciences

€1,330.00

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS). Cat# GE622A. Supplier: SBI System Biosciences Easily knock-in any gene into the AAVS1 Safe Harbor Site—your...

SGLT1 Plasmid | PVT7136

Nova Lifetech

€266.00

Product Name: SGLT1 PlasmidCat#: PVT7136Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.

pEnCMV-PGAM5-3 Plasmid | PVT18363

Nova Lifetech

€258.00

Product Name: pEnCMV-PGAM5-3 Plasmid Cat#: PVT18363Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.

pcDNA6/myc-HisA-WWP1 Plasmid | PVTB00443-2a

Nova Lifetech

€356.00

Product Name: pcDNA6/myc-HisA-WWP1 PlasmidCat#: PVTB00443-2aSupplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.

pCDNA3-PTGER2-EGFP Plasmid | PVT15867

Nova Lifetech

€325.00

Product Name: pCDNA3-PTGER2-EGFP Plasmid Cat#: PVT15867Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.

pCDNA3-Flag mTOR Plasmid | PVT14613

Nova Lifetech

€1,119.00

Product Name: pCDNA3-Flag mTOR Plasmid Cat#: PVT14613Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.

pCDNA3.1-UCA1 Plasmid | PVT18103

Nova Lifetech

€300.00

Product Name: pCDNA3.1-UCA1 Plasmid Cat#: PVT18103Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.

MC1061 Escherichia coli Strains | S0047

Nova Lifetech

€365.00

Product Name: MC1061 Escherichia coli StrainsCat#: S0047Supplier: Nova Lifetech / Life Science MarketAvailable with 5 to 7 Working days.

SV40 large T-antigen (GFP-Bsd), CMV lentiviral particles | LVP557-GB

GenTarget

€349.00

SV40 large T-antigen (GFP-Bsd), CMV lentiviral particles | LVP557-GB | GenTargetDescription:SV40 large T-antigen (GFP-Bsd), CMV lentiviral particlesStorage conditions: (-80°C)Shipping conditions: Dry...

SV40 large T-antigen (GFP-Bsd), CMV lentiviral particles | LVP016-GB

GenTarget

€349.00

SV40 large T-antigen (GFP-Bsd), CMV lentiviral particles | LVP016-GB | GenTargetDescription:SV40 large T-antigen (GFP-Bsd), CMV lentiviral particlesStorage conditions: (-80°C)Shipping conditions: Dry...

ZSWIM1 Clone BC001672

Cusabio

€214.00

ZSWIM1 Clone BC001672 | CusabioGene Name: ZSWIM1Gene ID: 90204Accession Number: BC001672Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

A1CF Clone BC130519

Cusabio

€347.00

A1CF Clone BC130519 | CusabioGene Name: A1CFGene ID: 29974Accession Number: BC130519Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

A1CF Clone BC054873

Cusabio

€214.00

A1CF Clone BC054873 | CusabioGene Name: A1CFGene ID: 29974Accession Number: BC054873Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUCSequence:...

Anti-Mesothelin (SS1) CAR2 Lentivirus | LVP752

ABMGood

€1,496.00

abm | Anti-Mesothelin (SS1) CAR2 Lentivirus | LVP752Quantity:10^8 IU/ml; 550 µlTiter:N/AShipping Condition:Dry IceStorage Condition:-80°C

Plasma Membrane Labeling Lentivirus (LCK)(RFP) | LVP713

ABMGood

€784.00

abm | Plasma Membrane Labeling Lentivirus (LCK)(RFP) | LVP713Quantity:10 x 100 µlTiter:10^7 IU/mlShipping Condition:Dry IceStorage Condition:-80°C

AAV Packaging Mix (Serotype 6) | AAV1006

ABMGood

€626.00

abm | AAV Packaging Mix (Serotype 6) | AAV1006Quantity:100 µgTiter:N/AShipping Condition:Ambient TemperatureStorage Condition:-20°C

AAV Packaging Mix (Serotype 5) & DNAfectin Combo Pack | AAV1005-G2100

ABMGood

€776.00

abm | AAV Packaging Mix (Serotype 5) & DNAfectin Combo Pack | AAV1005-G2100Quantity:1 KitTiter:N/AShipping Condition:Refer to Manual/DatasheetStorage Condition:Refer to Manual/Datasheet

Complete Lenti-HA Kit | LV200

ABMGood

€1,496.00

abm | Complete Lenti-HA Kit | LV200Quantity:1 KitTiter:N/AShipping Condition:Refer to Manual/DatasheetStorage Condition:Refer to Manual/Datasheet

XStamp Pro Streptavidin Customizable EV Targeting Kit

System Biosciences

€854.00

XStamp Pro Streptavidin Customizable EV Targeting Kit. Cat# XSTP900A. Supplier: SBI System Biosciences Quickly and easily create custom targeted EVs with XStamp Pro Streptavidin — no cloning...

XStamp Pro anti-PD-1 EV Targeting Kit

System Biosciences

€854.00

XStamp Pro anti-PD-1 EV Targeting Kit. Cat# XSTP915A. Supplier: SBI System Biosciences Engineer EVs to deliver cargo to cells expressing PD-1 on their surface using the streamlined XStamp Pro PD-1...

XStamp Pro anti-HIV EV Targeting Kit

System Biosciences

€854.00

XStamp Pro anti-HIV EV Targeting Kit. Cat# XSTP905A. Supplier: SBI System Biosciences7 Engineer EVs to deliver cargo to HIV-infected cells with XStamp Pro anti-HIV, a streamlined method for adding...

XStamp Pro anti-CD16 EV Targeting Kit

System Biosciences

€854.00

XStamp Pro anti-CD16 EV Targeting Kit. Cat# XSTP910A. Supplier: SBI System Biosciences Engineer EVs to deliver cargo to cells expressing CD16 on their surface using the streamlined XStamp Pro...

XPack CMV-XP-GFP-EF1-Puro Stable HEK293 Producer Cell Line

System Biosciences

€1,551.00

XPack CMV-XP-GFP-EF1-Puro Stable HEK293 Producer Cell Line. Cat# XPAK530CL. Supplier: SBI System Biosciences Label exosomes with GFP and track uptake into target cells with XPack...

SeraMir Exosome RNA Purification Column kit (20 exoRNA columns)

System Biosciences

€529.00

SeraMir Exosome RNA Purification Column kit (20 exoRNA columns). Cat# RA808A. Supplier: SBI System Biosciences

pCDH-UbC-MCS-EF1α-Hygro Cloning and Expression Lentivector — Add to Cart

Quick view

pCDH-UbC-MCS-EF1-Hygro cDNA Cloning and Expression Vector

System Biosciences

€674.00

pCDH-UbC-MCS-EF1-Hygro cDNA Cloning and Expression Vector. Cat# CD615B. Supplier: SBI System Biosciences Use the pCDH-UbC-MCS-EF1α-Hygro when you want low expression of your gene of interest...

pCDH-MSCV-MCS-EF1α-GFP+Puro Cloning and Expression Lentivector — Add to Cart

Quick view

pCDH-MSCV-MCS-EF1-GFP+Puro cDNA Cloning and Expression Vector

System Biosciences

€674.00

pCDH-MSCV-MCS-EF1-GFP+Puro cDNA Cloning and Expression Vector. Cat# CD713B. Supplier: SBI System Biosciences The pCDH-MSCV-MCS-EF1α-GFP+Puro lentivector uses the MSCV promoter for high...

pCDH-EF1α-MCS*-T2A-GFP Cloning and Expression Lentivector — Add to Cart

Quick view

pCDH-EF1-MCS*-T2A-GFP

System Biosciences

€695.00

pCDH-EF1-MCS*-T2A-GFP. Cat# CD526A. Supplier: SBI System Biosciences With the moderate EF1α promoter upstream of an MCS and a T2A element to co-express a GFP reporter, this lentivector is a...

ZZZ3 Clone BC035818

Write a Review

Cusabio

ZZZ3 Clone BC035818

Description

Related Products