null

ABCA8 Clone BC047765 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL001044HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCA8
Gene ID:
10351
Accession #:
BC047765
Vector:
pUC
€308.00
Frequently bought together:

Description

ABCA8 Clone BC047765 pUC | Cusabio

Gene Name: ABCA8

Gene ID: 10351

Accession Number: BC047765

Plasmid: pUC

Sequence: ATGAGGAAGAGAAAGATCAGTGTGTGTCAACAAACTTGGGCCTTATTATGCAAGAACTTTCTTAAAAAATGGAGAATGAAAAGAGAGTCCTTAATGGAATGGCTGAATTCATTGCTCCTACTACTTTGTTTGTATATATATCCTCATAGTCATCAAGTAAATGATTTTTCTTCACTGCTTACCATGGACCTGGGACGGGTAGATACATTTAATGAATCCAGATTTTCTGTTGTATACACACCTGTCACCAACACGACCCAACAGATAATGAATAAAGTAGCCTCTACTCCCTTCCTGGCAGGTAAAGAGGTCTTGGGACTGCCAGATGAGGAAAGTATTAAAGAATTCACAGCAAATTATCCTGAAGAAATAGTAAGAGTCACCTTTACTAATACATACTCATATCATTTGAAGTTCTTGCTAGGACATGGAATGCCAGCAAAGAAGGAGCACAAGGACCATACAGCTCATTGTTATGAAACAAATGAAGATGTTTACTGTGAAGTTTCAGTATTTTGGAAGGAAGGTTTTGTGGCTCTTCAAGCTGCCATTAATGCTGCTATTATAGAAATCACAACAAATCACTCAGTGATGGAGGAGCTGATGTCAGTTACTGGAAAAAATATGAAGATGCATTCCTTCATTGGTCAATCAGGAGTTATAACTGATTTGTACCTTTTTTCCTGCATTATTTCATTTTCCTCATTCATTTACTATGCATCTGTTAATGTCACAAGAGAGAGGAAAAGGATGAAGGCCTTGATGACAATGATGGGTCTTCGGGATTCAGCGTTCTGGTGA

Length: 801

View AllClose