null

ABCF3 Clone BC009253

(No reviews yet) Write a Review
SKU:
CSB-CL889115HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCF3
Gene ID:
55324
Accession #:
BC009253
Vector:
pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

ABCF3 Clone BC009253 | Cusabio

Gene Name: ABCF3

Gene ID: 55324

Accession Number: BC009253

Plasmid: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGACTTGCGCCGAAATCCTGCGGAGCGAGTTCCCCGAAATTGACGGACAAGTCTTCGACTACGTGACCGGCGTCTTGCACAGCGGCAGCGCGGACTTCGAGTCTGTGGATGACCTGGTGGAAGCTGTAGGGGAACTATTGCAAGAGGTGTCCGGGGACAGCAAGGATGACGCGGGCATCAGGGCCGTGTGCCAGCGCATGTACAACACTCTGCGTCTGGCTGAGCCACAAAGCCAGGGAAATAGCCAGGTGCTACTGGACGCCCCTATCCAGTTGTCAAAGATAACGGAGAACTACGACTGTGGAACCAAACTTCCAGGACTGCTAAAGAGGGAACAGTCCTCGACAGTGAATGCAAAGAAGTTAGAGAAGGCCGAGGCTCGACTTAAGGCAAAGCAGGAGAAGCGCTCAGAGAAGGACACGCTCAAGACCAGCAACCCTCTAGTCTTAGAAGAGGCATCAGCCAGCCAGGCAGGCAGCAGAAAGGAGAGTCGGTTGGAATCATCTGGCAAGAACAAATCCTATGATGTGCGAATTGAGAACTTTGATGTGTCTTTTGGCGATAGAGTACTGCTGGCTGGAGCGGATGTGAACCTGGCATGGGGCCGCCGTTACGGGCTGGTGGGGCGGAATGGGTTGGGGAAGACAACGTTACTGAAGATGCTGGCCACCCGGAGTCTGCGGGTTCCAGCCCACATTTCCCTGCTGCACGTTGAGCAAGAGGTTGCTGGAGATGACACTCCTGCCCTGCAGAGTGTGCTGGAGAGTGACAGTGTGCGAGAGGATTTGTTACGGAGGGAGCGGGAGCTCACTGCCCAGATTGCTGCTGGCAGGGCGGAGGGCTCTGAAGCTGCAGAGCTGGCAGAAATCTATGCCAAACTGGAGGAGATTGAGGCTGACAAGGCACCTGCCAGGGCATCAGTCATTCTCGCTGGGCTTGGCTTTACCCCTAAAATGCAGCAGCAGCCCACCCGGGAGTTCTCAGGTGGCTGGAGGATGAGGCTGGCCCTGGCCCGGGCCCTCTTTGCTAGGCCAGATCTTCTGCTGTTAGATGAACCTACAAACATGCTGGATGTCAGGGCCATCCTGTGGCTGGAGAATTACCTGCAGACGTGGCCCTCCACCATCCTAGTCGTCTCCCACGACCGCAACTTCTTGAATGCCATCGCCACAGACATCATCCACCTGCACAGCCAGCGGCTAGATGGTTACCGGGGAGACTTTGAGACCTTCATCAAGAGTAAGCAGGAGCGGCTGCTCAACCAGCAGCGTGAATATGAGGCGCAGCAGCAGTATCGCCAGCACATCCAGGTTTTCATTGACCGGTTTCGCTACAATGCCAACAGGGCCTCTCAAGTGCAGAGTAAACTCAAGATGCTGGAGAAGCTGCCTGAGCTGAAGCCTGTGGACAAGGAATCAGAGGTCGTAATGAAGTTCCCTGATGGGTTTGAGAAGTTCTCGCCGCCAATTCTGCAGCTAGATGAGGTGGATTTCTACTACGATCCGAAGCACGTCATCTTCAGTCGCCTCTCTGTGTCTGCTGATCTCGAGTCTCGCATCTGTGTGGTTGGAGAGAATGGGGCTGGGAAGTCTACCATGCTGAAGCTGCTTTTGGGGGACCTGGCACCTGTTCGGGGCATCAGACACGCTCACAGGAATCTGAAGATTGGCTATTTCAGCCAGCACCATGTGGAGCAGCTGGACCTAAACGTCAGTGCTGTGGAACTGCTGGCACGCAAGTTTCCTGGGCGGCCTGAGGAGGAGTACCGTCACCAGCTGGGTCGGTATGGCATCTCCGGAGAACTGGCCATGCGTCCTCTTGCCAGCCTGTCTGGGGGCCAGAAGAGCCGAGTGGCCTTTGCTCAGATGACTATGCCCTGCCCCAACTTCTACATTCTGGATGAACCCACAAACCACCTGGACATGGAGACCATTGAGGCTCTGGGCCGTGCCCTCAACAATTTCAGGGGTGGTGTGATTCTGGTGTCCCACGATGAGCGCTTTATCAGGCTGGTGTGCCGGGAGTTGTGGGTATGCGAAGGAGGCGGCGTCACCCGTGTGGAAGGAGGATTTGACCAGTACCGCGCCCTCCTCCAGGAACAGTTCCGCCGCGAAGGCTTCCTCTAG

Length: 2130

View AllClose