null

ABCG4 Clone BC041091 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL887952HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCG4
Gene ID:
64137
Accession #:
BC041091
Vector:
pUC
€604.00
Frequently bought together:

Description

ABCG4 Clone BC041091 pUC | Cusabio

Gene Name: ABCG4

Gene ID: 64137

Accession Number: BC041091

Plasmid: pUC

Sequence: ATGGCGGAGAAGGCGCTGGAGGCCGTGGGCTGTGGACTAGGGCCGGGGGCTGTGGCCATGGCCGTGACGCTGGAGGACGGGGCGGAACCCCCTGTGCTGACCACGCACCTGAAGAAGGTGGAGAACCACATCACTGAAGCCCAGCGCTTCTCCCACCTACCCAAGCGCTCAGCCGTGGACATCGAGTTCGTGGAGCTGTCCTATTCCGTGCGGGAGGGGCCCTGCTGGCGCAAAAGGGGTTATAAGACCCTTCTCAAGTGCCTCTCAGGTAAATTCTGCCGCCGGGAGCTGATTGGCATCATGGGCCCCTCAGGGGCTGGCAAGTCTACATTCATGAACATCTTGGCAGGATACAGGGAGTCTGGAATGAAGGGGCAGATCCTGGTTAATGGAAGGCCACGGGAGCTGAGGACCTTCCGCAAGATGTCCTGCTACATCATGCAAGATGACATGCTGCTGCCGCACCTCACGGTGTTGGAAGCCATGATGGTCTCTGCTAACCTGAAGCTGAGTGAGAAGCAGGAGGTGAAGAAGGAGCTGGTGACAGAGATCCTGACGGCACTGGGCCTGATGTCGTGCTCCCACACGAGGACAGCCCTGCTCTCTGGCGGGCAGAGGAAGCGTCTGGCCATCGCCCTGGAGCTGGTCAACAACCCGCCTGTCATGTTCTTTGATGAGCCCACCAGTGGTCTGGATAGCGCCTCTTGTTTCCAAGTGGTGTCCCTCATGAAGTCCCTGGCACAGGGGGGCCGTACCATCATCTGCACCATCCACCAGCCCAGTGCCAAGCTCTTTGAGATGTTTGACAAGCTCTACATCCTGAGCCAGGGTCAGTGCATCTTCAAAGGCGTGGTCACCAACCTGATCCCCTATCTAAAGGGACTCGGCTTGCATTGCCCCACCTACCACAACCCGGCTGACTTCATCATCGAGGTGGCCTCTGGCGAGTATGGAGACCTGAACCCCATGTTGTTCAGGGCTGTGCAGAATGGGCTGTGCGCTATGGCTGAGAAGAAGAGCAGCCCTGAGAAGAACGAGGTCCCTGCCCCATGCCCTCCTTGTCCTCCGGAAGTGGATCCCATTGAAAGCCACACCTTTGCCACCAGCACCCTCACACAGTTCTGCATCCTCTTCAAGAGGACCTTCCTGTCCATCCTCAGGGACACGGTCCTGACCCACCTACGGTTCATGTCCCACGTGGTTATTGGCGTGCTCATCGGCCTCCTCTACCTGCATATTGGCGACGATGCCAGCAAGGTCTTCAACAACACCGGCTGCCTCTTCTTCTCCATGCTGTTCCTCATGTTCGCCGCCCTCATGCCAACTGTGCTCACCTTCCCCTTAGAGATGGCGGTCTTCATGAGGGAGCACCTCAACTACTGGTACAGCCTCAAAGCGTATTACCTGGCCAAGACCATGGCTGACGTGCCCTTTCAGGTGGTGTGTCCGGTGGTCTACTGCAGCATTGTGTACTGGATGACGGGCCAGCCCGCTGAGACCAGCCGCTTCCTGCTCTTCTCAGCCCTGGCCACCGCCACCGCCTTGGTGGCCCAATCTTTGGGGCTGCTGATCGGAGCTGCTTCCAACTCCCTACAGGTGGCCACTTTTGTGGGCCCAGTTACCGCCATCCCTGTCCTCTTGTTCTCCGGCTTCTTTGTCAGCTTCAAGACCATCCCCACTTACCTGCAATGGAGCTCCTATCTCTCCTATGTCAGGTATGGCTTTGAGGGTGTGATCCTGACGATCTATGGCATGGAGCGAGGAGACCTGACATGTTTAGAGGAACGCTGCCCGTTCCGGGAGCCACAGAGCATCCTCCGAGCGCTGGATGTGGAGGATGCCAAGCTCTACATGGACTTCCTGGTCTTGGGCATCTTCTTCCTAGCCCTGCGGCTGCTGGCCTACCTTGTGCTGCGTTACCGGGTCAAGTCAGAGAGATAG

Length: 1941

View AllClose