null

ADC Clone BC010449 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL001330HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADC
Gene ID:
113451
Accession #:
BC010449
Vector:
pUC
€460.00
Frequently bought together:

Description

ADC Clone BC010449 pUC | Cusabio

Gene Name: ADC

Gene ID: 113451

Accession Number: BC010449

Plasmid: pUC

Sequence: ATGGCTGGCTACCTGAGTGAATCGGACTTTGTGATGGTGGAGGAGGGCTTCAGTACCCGAGACCTGCTGAAGGAACTCACTCTGGGGGCCTCACAGGCCACCACGGACGAGGTAGCTGCCTTCTTCGTGGCTGACCTGGGTGCCATAGTGAGGAAGCACTTTTGCTTTCTGAAGTGCCTGCCACGAGTCCGGCCCTTTTATGCTGTCAAGTGCAACAGCAGCCCAGGTGTGCTGAAGGTTCTGGCCCAGCTGGGGCTGGGCTTTAGCTGTGCCAACAAGGCAGAGATGGAGTTGGTCCAGCATATTGGAATCCCTGCCAGTAAGATCATCTGCGCCAACCCCTGTAAGCAAATTGCACAGATCAAATATGCTGCCAAGCATGGGATCCAGCTGCTGAGCTTTGACAATGAGATGGAGCTGGCAAAGGTGGTAAAGAGCCACCCCAGTGCCAAGATGGTTCTGTGCATTGCTACCGATGACTCCCACTCCCTGAGCTGCCTGAGCCTAAAGTTTGGAGTGTCACTGAAATCCTGCAGACACCTGCTTGAAAATGCGAAGAAGCACCATGTGGAGGTGGTGGGTGTGAGTTTTCACATTGGCAGTGGCTGTCCTGACCCTCAGGCCTATGCTCAGTCCATCGCAGACGCCCGGCTCGTGTTTGAAATGGGCACCGAGCTGGGTCACAAGATGCACGTTCTGGACCTTGGTGGTGGCTTCCCTGGCACAGAAGGGGCCAAAGTGAGATTTGAAGAGATTGCTTCCGTGATCAACTCAGCCTTGGACCTGTACTTCCCAGAGGGCTGTGGCGTGGACATCTTTGCTGAGCTGGGGCGCTACTACGTGACCTCGGCCTTCACTGTGGCAGTCAGCATCATTGCCAAGAAGGAGGTTCTGCTAGACCAGCCTGGCAGGGAGGAGGAAAATGGTTCCACCTCCAAGACCATCGTGTACCACCTTGATGAGGGCGTGTATGGGATCTTCAACTCAGTCCTGTTTGACAACATCTGCCCTACCCCCATCCTGCAGAAGAAACCATCCACGGAGCAGCCCCTGTACAGCAGCAGCCTGTGGGGCCCGGCGGTTGATGGCTGTGATTGCGTGGCTGAGGGCCTGTGGCTGCCGCAACTACACGTAGGGGACTGGCTGGTCTTTGACAACATGGGCGCCTACACTGTGGGCATGGGTTCCCCCTTTTGGGGGACCCAGGCCTGCCACATCACCTATGCCATGTCCCGGGTGGCCTGGGAAGCGCTGCGAAGGCAGCTGATGGCTGCAGAACAGGAGGATGACGTGGAGGGTGTGTGCAAGCCTCTGTCCTGCGGCTGGGAGATCACAGACACCCTGTGCGTGGGCCCTGTCTTCACCCCAGCGAGCATCATGTGA

Length: 1383

View AllClose