null

ADCK2 Clone BC014107 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL772029HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADCK2
Gene ID:
90956
Accession #:
BC014107
Vector:
pUC
€418.00
Frequently bought together:

Description

ADCK2 Clone BC014107 pUC | Cusabio

Gene Name: ADCK2

Gene ID: 90956

Accession Number: BC014107

Plasmid: pUC

Sequence: ATGGTGGCGCCCTGGCGCGTCTCCGTCAGGGTTTGCCTGTCGCACCTGAGGTGCTTCGAGCTCAGACAGGGACTCAGCCTCCTGAGGCCCTCCGAGTGCCCTCGCGATGCCAGGCTCTGCTGGCTTCTGCTGGGCACTTTGCCCAAGGTCGTCTCCCTGTGCGGGGACGTGGGTGAGGGGGCCCCTGACGTTCTGAGTCGGCGAAGGGTCCGCTGCAGCGGGGCGGCTGGCGCGGGGCCCGCGGAGAGCCTCCCCCGAGCGGGACCTCTGGGCGGCGTCTTCCTGCATCTCCGCCTCTGGCTTCGCGCCGGCGCTCTGTTGGTGAAATTCTTCCCCCTCCTACTCCTCTACCCCCTCACCTACCTGGCTCCCAGCGTCTCCACCCTCTGGCTCCACCTGCTTCTGAAAGCCACCGAGACCTCAGGCCCAACCTACATCAAACTGGGCCAGTGGGCCAGCACCCGGCGCGATCTGTTTTCGGAGGCTTTCTGTGCCCAATTTTCCAAGCTGCATGTCCGAGTGACGCCCCACCCGTGGACTCACACTGAGCGCTTCCTTCGGCAGGCTTTTGGGGATGACTGGGGGAGCATCCTCTCTTTTGAGAACCGGGAACCTGTGGGCTCAGGCTGCGTGGCCCAGGTGTACAAAGCATACGCCAACACTGCCTTCCTGGAGACTGACAGCGTCCAGAGACTTGGCAGGGCCTCCTGTCTGCCGCCCTTCTCACATACTGGGGCAGTCGGTGGGCTGAGAGAGCTCTTTGGATACCTTGGAAATGGCCGGAAACCTCCAGAAAATCTCGCAGACCAGTCGTTTCTAGAAAGGCTGCTCCTCCCTAAAGCTGACCTGGTTGGATCAAATGCAGGGGTGTCTCGGGCTCAGGTCCCTGGCCACCAACCTGAGGCCACCAACCTCATCTCCGTGGCAGTGAAAGTGTTGCACCCTGGCCTGCTCGCTCAGGTGCATATGGACCTGCTGCTGATGAAGATTGGCAGCCGAGTCCTGGGAGTTTTGCCAGGCATCAAGTGGCTTAGCTTGCCTGAGATTGTGGAGGAATTTGAGAAGCTGATGGTCCAACAGATTGACCTGCGTTACGAAGCTCAGAATCTAGAACACTTCCAGGTCAACTTCCGGAATGTGAAAGCCGTCAAGTTCCCCACTCCCAAGAGCCTCTCCTATGGCAGCTGGGACGTTTTAAAATTGGGACACCAATTTCAAATGTAA

Length: 1224

View AllClose