Cusabio

AQP11 Clone BC040443 pENTR223.1

(No reviews yet) Write a Review
SKU:
CSB-CL847678HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
AQP11
Gene ID:
282679
Accession #:
BC040443
Vector:
pENTR223.1
$256.80

Description

AQP11 Clone BC040443 pENTR223.1 | Cusabio

Gene Name: AQP11

Gene ID: 282679

Accession Number: BC040443

Plasmid: pENTR223.1

Sequence: ATGTCGCCGCTGCTGGGGCTCCGGTCCGAGCTGCAGGACACCTGCACCTCGCTGGGACTGATGCTGTCGGTGGTGCTGCTCATGGGGCTGGCCCGCGTAGTCGCCCGGCAGCAGCTGCACAGGCCGGTGGCCCACGCCTTCGTCCTGGAGTTTCTAGCCACCTTCCAGCTCTGCTGCTGCACCCACGAGCTGCAACTGCTGAGCGAACAGCACCCCGCGCACCCCACCTGGACGCTGACGCTCGTCTACTTCTTCTCGCTTGTGCATGGCCTGACTCTGGTGGGCACGTCCAGCAACCCGTGCGGCGTGATGATGCAGATGATGCTGGGGGGCATGTCCCCCGAGACGGGTGCGGTGAGGCTATTGGCTCAGCTGGTTAGTGCCCTGTGCAGCAGGTACTGCACAAGCGCCTTGTGGAGCTTGGGTCTGACCCAGTATCACGTCAGCGAGAGGAGCTTCGCTTGCAAGAATCCCATCCGAGTCGACTTGCTCAAAGCGGTCATCACAGAGGCCGTCTGCTCCTTTCTCTTCCACAGCGCTCTGCTGCACTTCCAGGAAGTCCGAACCAAGCTTCGTATCCACCTGCTGGCTGCACTCATCACCTTTTTGGTCTATGCAGGAGGAAGTCTAACAGGAGCTGTATTTAATCCAGCTTTGGCACTTTCGCTACATTTCATGTGTTTTGATGAAGCATTCCCTCAGTTTTTTATAGTATACTGGCTGGCTCCTTCTTTAGGTATATTGTTGATGATTTTGATGTTCAGCTTTTTCCTTCCATGGCTGCATAACAACCATACAATTAATAAAAAGGAATAA

Length: 816

View AllClose