null

MMRN1 Clone BC063848 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL622645HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
MMRN1
Gene ID:
22915
Accession #:
BC063848
Vector:
pUC
€1,206.00
Frequently bought together:

Description

MMRN1 Clone BC063848 pUC | Cusabio

Gene Name: MMRN1

Gene ID: 22915

Accession Number: BC063848

Plasmid: pUC

Sequence: ATGAAGGGGGCAAGATTATTTGTCCTTCTTTCTAGTTTATGGAGTGGGGGCATTGGGCTTAACAACAGTAAGCATTCTTGGACTATACCTGAGGATGGGAACTCTCAGAAGACTATGCCTTCTGCTTCAGTTCCTCCAAATAAAATACAAAGTTTGCAAATACTGCCAACCACTCGGGTCATGTCGGCGGAGATAGCTACAACTCCAGAGGCAAGAACTTCTGAAGACAGTCTTCTTAAATCAACACTGCCTCCCTCAGAAACAAGTGCACCTGCTGAGGGTGTGAGAAATCAAACTCTCACATCCACAGAGAAAGCAGAAGGAGTGGTCAAGTTACAGAATCTTACCCTCCCAACCAACGCTAGCATCAAGTTCAATCCTGGAGCAGAATCAGTGGTCCTTTCCAATTCTACACTGAAATTTCTTCAGAGCTTTGCCAGAAAGTCAAATGAACAAGCAACTTCTCTAAACACAGTTGGAGGCACTGGAGGCATTGGAGGCGTTGGAGGCACTGGAGGCGTGGGAAATCGAGCCCCACGGGAAACATACCTCAGCCGGGGTGACAGCAGTTCCAGCCAAAGAACTGACTACCAAAAATCAAATTTCGAAACAACTAGAGGAAAGAATTGGTGTGCTTATGTACATACCAGGTTATCTCCCACAGTGATATTGGACAACCAGGTCACTTATGTCCCAGGTGGGAAAGGACCTTGTGGCTGGACCGGTGGATCCTGTCCTCAGAGATCTCAGAAGATATCCAATCCTGTCTATAGGATGCAACATAAAATTGTCACCTCATTGGATTGGAGGTGCTGTCCTGGATACAGTGGGCCGAAATGTCAACTAAGAGCCCAGGAACAGCAAAGTTTGATACACACCAACCAGGCTGAAAGTCATACAGCTGTTGGCAGAGGAGTAGCTGAGCAGCAGCAGCAGCAAGGCTGTGGTGACCCAGAAGTGATGCAAAAAATGACTGATCAGGTGAACTACCAGGCAATGAAACTGACTCTTCTGCAGAAGAAGATTGACAATATTTCTTTGACTGTGAATGATGTAAGGAACACTTACTCCTCCCTAGAAGGAAAAGTCAGCGAAGATAAAAGCAGAGAATTTCAATCTCTTCTAAAAGGTCTAAAATCCAAAAGCATTAATGTACTGATAAGAGACATAGTAAGAGAACAATTTAAAATTTTTCAAAATGACATGCAAGAGACTGTAGCACAGCTCTTCAAGACTGTATCAAGTCTATCAGAGGACCTCGAAAGCACCAGGCAAATAATTCAAAAAGTTAATGAATCTGTGGTTTCAATAGCAGCCCAGCAAAAGTTTGTTTTGGTGCAAGAGAATCGGCCCACTTTGACTGATATAGTGGAACTAAGGAATCACATTGTGAATGTAAGGCAAGAAATGACTCTTACATGTGAGAAGCCTATTAAAGAACTAGAAGTAAAGCAGACTCATTTAGAAGGTGCTCTAGAACAGGAACACTCAAGAAGCATTCTGTATTATGAATCCCTCAATAAAACTCTTTCTAAATTGAAGGAAGTACATGAGCAGCTTTTATCAACTGAACAGGTATCAGACCAGAAGAATGCTCCAGCTGCTGAGTCAGTTAGCAATAATGTCACTGAGTACATGTCTACTTTACATGAAAATATAAAGAAGCAGAGTTTGATGATGCTGCAAATGTTTGAAGATTTGCACATTCAAGAAAGCAAGATTAACAATCTCACCGTCTCTTTGGAGATGGAGAAAGAGTCTCTCAGAGGTGAATGTGAAGACATGTTATCCAAATGCAGAAATGATTTTAAATTTCAACTTAAGGACACAGAAGAGAATTTACATGTGTTAAATCAAACATTGGCTGAAGTTCTCTTTCCAATGGACAATAAGATGGACAAAATGAGTGAGCAACTAAATGATTTGACTTATGATATGGAGATCCTTCAACCCTTGCTTGAGCAGGGAGCATCACTCAGACAGACAATGACATATGAACAACCAAAGGAAGCAATAGTGATAAGGAAAAAGATAGAAAATCTGACTAGTGCTGTCAATAGTCTAAATTTTATTATCAAAGAACTTACAAAAAGACACAACTTACTTAGAAATGAAGTACAGGGTCGTGATGATGCCTTAGAAAGACGTATCAATGAATATGCCTTAGAAATGGAAGATGGCCTCAATAAGACAATGACTATTATAAATAATGCTATTGATTTCATTCAAGATAACTATGCCCTAAAAGAGACTTTAAGTACTATTAAGGATAATAGTGAGATCCATCATAAATGTACCTCCGATATGGAAACTATTTTGACATTTATTCCTCAGTTCCACCGTCTGAATGATTCTATTCAGACTTTGGTCAATGACAATCAGAGATATAACTTTGTTTTGCAAGTCGCCAAGACCCTTGCAGGTATTCCCAGAGATGAGAAACTAAATCAGTCCAACTTCCAAAAGATGTATCAAATGTTCAATGAAACCACTTCCCAAGTGAGAAAATACCAGCAAAATATGAGTCATTTGGAAGAAAAACTACTCTTAACTACCAAGATTTCCAAAAATTTTGAGACTCGGTTGCAAGACATTGAGTCTAAAGTTACCCAGACGCTCATACCTTATTATATTTCAGTTAAAAAAGGCAGTGTAGTTACAAATGAGAGAGATCAGGCTCTTCAACTGCAAGTATTAAATTCCAGATTTAAGGCGTTGGAAGCAAAATCTATCCATCTTTCAATTAACTTCTTTTCGCTTAACAAAACTCTCCACGAAGTTTTAACAATGTGTCACAATGCTTCTACAAGTGTGTCAGAACTGAATGCTACCATCCCTAAGTGGATAAAACATTCCCTGCCAGATATTCAACTTCTTCAGAAAGGTCTAAGAGAATTTGTGGAACCAATAATTCAAATAAAAACTCAAGCTGCCCTATCTAATTTAACTTGTTGTATAGATCGATCGTTGCCTGGTAGTCTGGCAAATGTTGTCAAGTCTCAGAAGCAAGTAAAATCATTGCCAAAGAAAATTAACGCACTTAAGAAACCAACGGTAAATCTTACCACAGTCCTGATAGGCCGGACTCAAAGAAACACGGACAACATAATATATCCTGAGGAGTATTCAAGCTGTAGTCGGCATCCGTGCCAAAATGGGGGCACGTGCATAAATGGAAGAACTAGCTTTACCTGTGCCTGCAGACATCCTTTTACTGGTGACAACTGCACTATCAAGCTTGTGGAAGAAAATGCTTTAGCTCCAGATTTTTCCAAAGGATCTTACAGATATGCACCCATGGTGGCATTTTTTGCATCTCATACGTATGGAATGACTATACCTGGTCCTATCCTGTTTAATAACTTGGATGTCAATTATGGAGCTTCATATACCCCAAGAACTGGAAAATTTAGAATTCCGTATCTTGGAGTATATGTTTTCAAGTACACCATCGAGTCATTTAGTGCTCATATTTCTGGATTTTTAGTGGTTGATGGAATAGACAAGCTTGCATTTGAGTCTGAAAATATTAACAGTGAAATACACTGTGATAGGGTTTTAACTGGGGATGCCTTATTAGAATTAAATTATGGGCAGGAAGTCTGGTTACGACTTGCAAAAGGAACAATTCCAGCCAAGTTTCCCCCTGTTACTACATTTAGTGGCTATTTATTATATCGTACATAA

Length: 3687

View AllClose