SEC24D Clone BC035761 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL020953HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SEC24D
Gene ID:
9871
Accession #:
BC035761
Vector:
pUC
€1,060.00
Frequently bought together:

Description

SEC24D Clone BC035761 pUC | Cusabio

Gene Name: SEC24D

Gene ID: 9871

Accession Number: BC035761

Plasmid: pUC

Sequence: ATGAGTCAACAAGGTTACGTGGCTACACCTCCGTATTCTCAGCCTCAGCCTGGAATAGGCCTTTCTCCACCTCATTATGGGCACTATGGGGATCCGTCGCACACAGCATCTCCAACAGGTATGATGAAGCCAGCAGGGCCTTTGGGGGCCACCGCCACTAGGGGAATGTTGCCTCCGGGTCCCCCACCTCCTGGACCCCATCAGTTTGGTCAGAATGGAGCTCATGCCACTGGTCACCCTCCCCAAAGATTTCCAGGCCCTCCACCTGTCAACAATGTGGCATCCTCACATGCACCATACCAACCCTCTGCACAATCTTCTTATCCAGGTCCTATATCCACTTCATCTGTCACCCAGCTGGGCAGCCAGCTCAGTGCTATGCAAATCAACAGCTATGGTTCAGGCATGGCTCCTCCAAGCCAGGGACCCCCTGGCCCTCTGTCAGCCACATCATTGCAGACTCCTCCACGACCTCCACAGCCTTCCATTTTGCAGCCTGGATCTCAAGTTCTTCCACCACCACCCACCACACTCAATGGTCCTGGTGCCTCACCTTTGCCTCTACCAATGTACAGACCAGATGGGCTCTCTGGGCCTCCTCCTCCAAATGCCCAGTACCAGCCCCCACCTCTTCCAGGCCAGACCTTGGGTGCTGGATATCCTCCGCAGCAGGCAGCCAACTCTGGTCCCCAGATGGCAGGCGCACAACTGTCTTACCCAGGAGGCTTCCCTGGAGGTCCTGCACAGATGGCTGGTCCGCCACAGCCCCAGAAGAAGCTGGATCCTGACTCTATCCCTAGCCCAATCCAGGTGATTGAGAATGATAGAGCCAGCAGAGGAGGACAAGTTTATGCCACCAACACCAGAGGCCAGATCCCTCCCCTGGTCACTACAGATTGCATGATACAAGACCAAGGAAATGCCAGTCCTCGATTCATCCGTTGTACAACATACTGTTTTCCATGCACGTCAGATATGGCTAAGCAAGCTCAGATTCCATTAGCTGCTGTCATCAAGCCCTTTGCCACCATTCCTTCAAATGAGAGTCCCCTTTACTTGGTAAATCACGGCGAGAGTGGACCAGTCAGATGCAACAGGTGCAAGGCCTACATGTGCCCATTTATGCAGTTCATCGAAGGAGGAAGGAGATATCAGTGTGGATTTTGCAACTGTGTGAATGATGTTCCACCATTCTATTTCCAACATCTGGACCACATTGGAAGAAGACTGGACCACTATGAGAAACCAGAGTTATCTCTAGGATCTTATGAATATGTTGCCACTTTGGATTATTGCAGAAAGAGTAAGCCTCCCAACCCACCAGCCTTTATCTTCATGATTGATGTTTCATATAGTAACATAAAGAATGGACTTGTCAAGCTCATATGTGAAGAACTGAAGACCATGCTGGAAAAAATTCCAAAGGAAGAGCAAGAAGAGACGTCTGCAATTCGAGTGGGTTTTATCACATATAACAAAGTTCTCCATTTCTTTAATGTGAAGAGTAATCTGGCCCAGCCTCAGATGATGGTGGTGACTGATGTTGGAGAAGTCTTTGTTCCTTTGTTGGATGGTTTCCTTGTCAACTATCAAGAATCCCAATCTGTGATTCATAATTTGTTGGACCAGATTCCAGACATGTTTGCAGACTCTAATGAAAATGAGACTGTCTTTGCTCCTGTCATCCAGGCTGGCATGGAAGCACTAAAGGCAGCAGACTGTCCTGGGAAGCTGTTCATCTTCCATTCTTCCTTGCCAACTGCTGAAGCACCAGGGAAGCTCAAAAACAGAGATGACAAAAAACTGGTTAATACAGACAAAGAGAAGATACTTTTCCAGCCCCAAACAAATGTCTATGACTCATTGGCCAAGGACTGCGTGGCTCACGGCTGCTCTGTGACACTCTTCCTCTTTCCTAGTCAGTATGTGGACGTGGCCTCGCTGGGGCTGGTTCCTCAGCTCACTGGAGGAACCCTTTACAAATACAACAATTTCCAGATGCACTTGGATAGACAACAATTTTTGAACGACCTCAGAAATGATATTGAAAAGAAAATAGGCTTTGATGCTATTATGAGGGTTCGTACCAGCACAGGTTTCAGAGCCACTGATTTCTTTGGTGGAATCTTGATGAACAACACCACCGATGTAGAAATGGCTGCCATCGATTGTGACAAGGCAGTGACCGTGGAGTTCAAGCACGATGACAAACTCAGTGAAGACAGTGGAGCCTTAATCCAGTGTGCTGTGCTTTACACGACAATCAGTGGTCAAAGAAGACTTCGGATTCACAATCTTGGCTTAAACTGCAGCTCTCAGCTAGCTGATCTTTATAAGAGCTGTGAGACAGATGCTCTTATCAACTTCTTTGCCAAGTCAGCTTTTAAAGCAGTTCTTCACCAGCCTTTGAAGGTCATCCGGGAAATTCTAGTTAATCAGACTGCCCATATGTTGGCATGTTACCGGAAGAATTGTGCAAGTCCTTCTGCAGCAAGCCAGCTTATTCTACCAGATTCCATGAAAGTATTGCCAGTGTACATGAATTGCTTGTTGAAAAACTGTGTACTACTCAGCAGACCAGAGATCTCAACTGATGAACGAGCATACCAGAGACAGCTGGTCATGACCATGGGTGTGGCTGACTCTCAGCTTTTCTTCTACCCACAACTTCTGCCCATACACACGTTAGATGTCAAGAGTACAATGTTACCTGCTGCCGTTCGTTGCTCTGAGTCCCGTCTTTCAGAAGAAGGAATATTCTTACTGGCTAATGGTCTACACATGTTCCTGTGGTTGGGAGTAAGCAGCCCACCAGAACTGATCCAAGGAATATTTAATGTGCCATCTTTTGCACATATCAACACAGATATGACATTGCTGCCTGAAGTGGGAAACCCATACTCTCAACAACTCAGAATGATAATGGGTATTATCCAACAAAAGAGGCCATATTCAATGAAGCTCACAATTGTAAAGCAGCGAGAACAACCAGAAATGGTTTTCCGACAGTTCCTGGTAGAAGACAAAGGACTTTACGGAGGCTCTTCTTATGTGGATTTCCTTTGTTGTGTTCACAAGGAGATCTGTCAGCTGCTTAATTAA

Length: 3102

View AllClose