null

SERINC5 Clone BC101280 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL021050HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SERINC5
Gene ID:
256987
Accession #:
BC101280
Vector:
pUC
$513.60
Frequently bought together:

Description

SERINC5 Clone BC101280 pUC | Cusabio

Gene Name: SERINC5

Gene ID: 256987

Accession Number: BC101280

Plasmid: pUC

Sequence: ATGTCAGCTCAGTGCTGTGCGGGCCAGCTGGCCTGCTGCTGTGGGTCTGCAGGCTGCTCTCTCTGCTGTGATTGCTGCCCCAGGATTCGGCAGTCCCTCAGCACCCGCTTCATGTACGCCCTCTACTTCATTCTGGTCGTCGTCCTCTGCTGCATCATGATGTCAACAACCGTGGCTCACAAGATGAAAGAGCACATTCCTTTTTTTGAAGATATGTGTAAAGGCATTAAAGCTGGTGACACCTGTGAGAAGCTGGTGGGATATTCTGCCGTGTATAGAGTCTGTTTTGGAATGGCTTGTTTCTTCTTTATCTTCTGTCTACTGACCTTGAAAATCAACAACAGCAAAAGTTGTAGAGCTCATATTCACAATGGCTTTTGGTTCTTTAAACTTCTGCTGTTGGGGGCCATGTGCTCAGGAGCTTTCTTCATTCCAGATCAGGACACCTTTCTGAACGCCTGGCGCTATGTGGGAGCCGTCGGAGGCTTCCTCTTCATTGGCATCCAGCTCCTCCTGCTCGTGGAGTTTGCACATAAGTGGAACAAGAACTGGACAGCAGGCACAGCCAGTAACAAGCTGTGGTACGCCTCCCTGGCCCTGGTGACGCTCATCATGTATTCCATTGCCACTGGAGGCTTGGTTTTGATGGCAGTGTTTTATACACAGAAAGACAGCTGCATGGAAAACAAAATTCTGCTGGGAGTAAATGGAGGCCTGTGCCTGCTTATATCATTGGTAGCCATCTCACCCTGGGTCCAAAATCGACAGCCACACTCGGGGCTCTTACAATCAGGGGTCATAAGCTGCTATGTCACCTACCTCACCTTCTCAGCTCTGTCCAGCAAACCTGCAGAAGTAGTTCTAGATGAACATGGGAAAAATGTTACAATCTGTGTGCCTGACTTTGGTCAAGACCTGTACAGAGATGAAAACTTGGTGACTATACTGGGGACCAGCCTCTTAATCGGATGTATCTTGTATTCATGTTTGACATCAACAACAAGATCGAGTTCTGACGCTCTGCAGGGGCGATACGCAGCTCCTGAATTGGAGATAGCTCGCTGTTGTTTTTGCTTCAGTCCTGGTGGAGAGGACACTGAAGAGCAGCAGCCGGGGAAGGAGGGACCACGGGTCATTTATGACGAGAAGAAAGGCACCGTCTACATCTACTCCTACTTCCACTTCGTGTTCTTCCTAGCTTCCCTGTATGTGATGATGACCGTCACCAACTGGTTCAAAAGTGCCTTTCACCTCCTGCCATGA

Length: 1263

View AllClose