null

SFI1 Clone BC129926 pUC

(No reviews yet) Write a Review
SKU:
CSB-CL021132HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
SFI1
Gene ID:
9814
Accession #:
BC129926
Vector:
pUC
$1,209.60
Frequently bought together:

Description

SFI1 Clone BC129926 pUC | Cusabio

Gene Name: SFI1

Gene ID: 9814

Accession Number: BC129926

Plasmid: pUC

Sequence: ATGGAGAAGAAGGTTGATTCCAGATTTTACTATGAGCAGCGATTACTACGGAAGGTCTTCGAAGAATGGAAAGAGGAGTGGTGGGTTTTCCAGCACGAGTGGAAACTCTGTGTTCGAGCTGACTGTCACTACAGGGTGTGGTGGAGCACGTGGAGGCAGCGACTAGGACAGGTCCGTGTGAGCCGTGCCCTCCATGCCTCTGCTTTGAAGCACAGGGCCCTGAGCCTCCAGGTGCAGGCTTGGTCACAGTGGCGGGAACAGCTCCTGTATGTCCAGAAGGAGAAACAAAAGGTTGTCTCTGCAGTGAAACATCATCAGCACTGGCAAAAACGGAGATTTCTAAAGGCCTGGCTTGAATACCTGCAAGTCCGCAGAGTGAAGAGACAGCAGAATGAGATGGCTGAGCGATTCCATCATGTCACTGTGCTCCAGATACACTTCTGTGACTGGCAGCAGGCCTGGGAGCGGAGGGAGAGCTTGTACGCTCACCATGCCCAGGTGGAGAAACTGGCCAGGAAGATGGCCCTGCGGCGCGCCTTTACTCACTGGAAACACTACATGCTGCTGTGTGCAGAAGAAGCTGCCCAGTTTGAGATGGCAGAAGAGCACCACAGGCACAGCCAGCTGTATTTTTGCTTTAGAGCCCTAAAAGACAATGTGACCCACGCTCATCTCCAGCAAATAAGAAGGAATCTTGCTCACCAGCAGCATGGTGTCACGCTGCTGCACAGGTTCTGGAACCTCTGGCGGTCTCAGATTGAGCAGAAAAAGGAAAGAGAGCTGCTCCCCTTACTGCATGCTGCCTGGGACCACTACAGAATAGCACTGCTGTGCAAATGTATCGAATTGTGGCTACAGTATACTCAGAAGAGGCGGTACAAGCAGCTGCTACAGGCCAGAGCGGATGGTCATTTCCAGCAGAGAGCCCTGCCTGCTGCCTTCCACACATGGAACAGACTCTGGCGATGGCGCCACCAGGAAAATGTCCTCAGTGCAAGAGCAACACGTTTCCACAGGGAGACATTAGAGAAGCAAGTATTTTCTCTCTGGAGGCAGAAGATGTTTCAGCATCGAGAAAACCGCCTGGCAGAGAGAATGGCCATCCTTCACGCAGAGCAACAGCTTCTGTATAGGTCTTGGTTCATGTGGCACCAGCAGGCAGCAGCACGTCACCAGGAGCAGGAGTGGCAAACAGTGGCCTGTGCCCACCACCGCCACGGGCGGCTCAAGAAAGCTTTCTGCCTCTGGAGGGAAAGTGCCCAAGGGCTCAGAACAGAGAGGACGGGCAGGGTGCGGGCAGCAGAATTCCACATGGCCCAGCTCCTGCGTTGGGCCCGGAGCCAGTGGAGGGAGTGCCTGGCCCTGCGGGGAGCGGAGCGGCAGAAGCTGATGCGAGCAGACCTGCACCACCAGCACAGCGTGCTGCACAGGGCGCTGCAGGCATGGGTGACTTACCAGGGCAGGGTGCGAAGCATCCTCCGGGAGGTGGCAGCCAGGGAGAGCCAGCACAACAGGCAGCTGCTGCGCGGGGCATTACGTCGCTGGAAAGAGAACACCATGGCCCGAGTGGATGAAGCCAAAAAAACCTTTCAAGCAAGTACTCATTACAGAAGGACCATATGTTCCAAGGTCCTGGTCCAGTGGCGGGAAGCTGTGTCAGTGCAGATGTATTACCGACAGCAGGAGGACTGTGCCATCTGGGAGGCCCAGAAGGTGCTGGACAGGGGCTGTCTGCGGACCTGGTTTCAGCGCTGGTGGGACTGCAGCCGGAGGTCAGCCCAGCAGAGACTGCAGCTGGAGAGGGCAGTGCAACACCACCACCGGCAGCTGCTGCTGGAGGGGCTGGCCCGGTGGAAGACGCACCATCTGCAGTGTGTCAGGAAGAGGCTCCTGCACAGGCAGAGCACCCAACTGCTGGCACAGAGACTCAGCCGGACCTGCTTCCGCCAGTGGAGACAACAGCTGGCAGCCAGGAGGCAGGAGCAGCGGGCGACAGTGCGGGCCCTGTGGTTCTGGGCCTTCTCGCTGCAGGCAAAGGTGTGGGCCACGTGGCTGGCCTTTGTACTGGAAAGGAGGAGAAAGAAGGCGCGGCTGCAGTGGGCGCTCCAGGCCTACCAGGGGCAGCTCCTCCAGGAGGGTGCCACGCGGCTCCTGCGCTTTGCAGCCAGCATGAAGGCCTCCCGGCAGCAGCTGCAGGCCCAGCAGCAGGTCCAGGCGGCTCACAGTCTCCATCGTGCCGTCCGCCGCTGTGCCACGCTCTGGAAACAGAAAGTGCTGGGCCGGGGCGGGAAGCCTCAGCCCCTGGCAGCCATCGCACCCAGCAGGAAAGTGACGTTTGAGGGTCCCCTTCTCAACCGCATTGCTGCTGGGGCTGGGGATGGCACCCTTGAGACCAAGAGGCCACAGGCTTCTCGGCCTCTGGGAGCTCTGGGCCGCCTGGCTGCTGAGGAGCCCCACGCCCTGGAGCTCAACACTGCCCACTCAGCGAGGAAGCAGCCGCGACGCCCACACTTCCTGTTGGAGCCTGCGCAGAGCCAGAGGCCTCAGAAGCCACAGGAACATGGCCTAGGCATGGCTCAGCCAGCAGCCCCCTCCCTGACGCGGCCCTTCCTGGCAGAGGCCCCGACAGCACTGGTCCCACACAGCCCCCTGCCTGGGGCCCTGTCAAGCGCCCCTGGCCCGAAGCAGCCCCCGACGGCAAGCACAGGCCCGGAGCTGCTGCTGCTGCCTCTTTCCTCCTTCATGCCCTGCGGGGCGGCTGCACCAGCCAGGGTGTCAGCACAGCGGGCTACTCCTAGGGATAAGCCCCCGGTCCCCTCATCCCTGGCCAGTGTCCCTGACCCCCATCTACTCCTTCCTGGGGACTTCTCAGCCACCAGGGCTGGGCCTGGACTTTCAACTGCAGCCTGGACCTTGAGGCTGAACTTGAGGAGATCCAGCAGCAACTACTGCACTACCAGACCACCAAGCAGAACCTCTGGTCCTGTCGGCGGCAAGCGAGCAGCCTGCGCAGGTGGCTGGAGCTGA

Length: 3027

View AllClose